View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_241 (Length: 205)
Name: NF9661A_low_241
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_241 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 22 - 181
Target Start/End: Complemental strand, 45343139 - 45342980
Alignment:
| Q |
22 |
tggagttgggagtaataggcccgcaaacatcagcatgtacaagctgcaatttttgggaagctctccattgactcttctttggaatggcatctctatgttg |
121 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343139 |
tggagttgggagtaataggcccgcaaatatcagcatgtacaagctgcaatttatgggaagctctccattgactcttctttggaatggcatctctatgttg |
45343040 |
T |
|
| Q |
122 |
cttgccgacaaaacattcagtacaacttttatttgaagctttaacaagtggaaggccctt |
181 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343039 |
cttgctgacaaaacattcagtacaacttttatttgaagctttaacaagtggaaggccctt |
45342980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University