View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_252 (Length: 201)
Name: NF9661A_low_252
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_252 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 3e-62; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 24 - 183
Target Start/End: Complemental strand, 45643575 - 45643418
Alignment:
| Q |
24 |
gcaattacataaagctaacccattatatctcaattctcaaacaagattctcgtagcctccttgattaaaatggctttctctaatgctttgattttatgct |
123 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45643575 |
gcaattacataaagctaaaccattat--ctcaattctcaaataagatcctcgtagcttccttgattaaaatggctttctctaatgctttggttttatgct |
45643478 |
T |
 |
| Q |
124 |
tctttttagctatcactatggcattgccgactctggcaacaaaccatattgttggagatg |
183 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45643477 |
tctttttagctatcactatgccattgccgactctggcaacaaaccacattgttggagatg |
45643418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 87 - 183
Target Start/End: Original strand, 45702816 - 45702912
Alignment:
| Q |
87 |
attaaaatggctttctctaatgctttgattttatgcttctttttagctatcactatggcattgccgactctggcaacaaaccatattgttggagatg |
183 |
Q |
| |
|
||||||||| | |||| ||| |||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45702816 |
attaaaatgacattctttaaggctttggttttatgcttctttttagcgatcactatgccattgccgactctggcaacaaaccacattgttggagatg |
45702912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 87 - 183
Target Start/End: Original strand, 45886628 - 45886724
Alignment:
| Q |
87 |
attaaaatggctttctctaatgctttgattttatgcttctttttagctatcactatggcattgccgactctggcaacaaaccatattgttggagatg |
183 |
Q |
| |
|
||||||||| | |||| ||| |||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45886628 |
attaaaatgacattctttaaggctttggttttatgcttctttttagcgatcactatgccattgccgactctggcaacaaaccacattgttggagatg |
45886724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 163
Target Start/End: Complemental strand, 45650815 - 45650751
Alignment:
| Q |
99 |
ttctctaatgctttgattttatgcttctttttagctatcactatggcattgccgactctggcaac |
163 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| |||| | ||||| |||| ||||| ||||| |
|
|
| T |
45650815 |
ttctctaatcctttgattttaggcttctttttagtgatcaatgtggcagtgccaactcttgcaac |
45650751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University