View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_36 (Length: 367)
Name: NF9661A_low_36
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_36 |
 |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0119 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 9 - 290
Target Start/End: Original strand, 22561 - 22845
Alignment:
| Q |
9 |
gagatgaaaaatgaaagaaatagagataagttttgagacatacatggtggtgcgcgagcgaagagaggttgcc-attggtggtagtggtgttgtttcgtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||| | |||||| |||||||| |
|
|
| T |
22561 |
gagatgaaaaatgaaagaaatagagataagttttgagacatacatggtggtgcgcgagcgaagagaggttgcagagagttggaattggtgt-gtttcgtt |
22659 |
T |
 |
| Q |
108 |
gtggtgctattttgcagaatcgtaatttggtatcaactcaactatagtctctctcacctattctattcgagttcgatccggtttctctatttcgggtcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22660 |
gtggtgctattttgcagaatcgtaatttggtatcaactcaactatagtctctctcccttattctattcgggttcgatccggtttctctatttcgggtcaa |
22759 |
T |
 |
| Q |
208 |
accatcctacttcttcatttctaaatatttttaaagagta---ataaacaaatggatagtgttaacgtgtacccttaaggcaaccc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22760 |
accatcctacttcttcatttctaaatatttttaaagagtactgataaacaaatgggtagtgttaacgtgtacccttaaggcaaccc |
22845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 9 - 290
Target Start/End: Complemental strand, 1278530 - 1278246
Alignment:
| Q |
9 |
gagatgaaaaatgaaagaaatagagataagttttgagacatacatggtggtgcgcgagcgaagagaggttgcc-attggtggtagtggtgttgtttcgtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||| | |||||| |||||||| |
|
|
| T |
1278530 |
gagatgaaaaatgaaagaaatagagataagttttgagacatacatggtggtgcgcgagcgaagagaggttgcagagagttggaattggtgt-gtttcgtt |
1278432 |
T |
 |
| Q |
108 |
gtggtgctattttgcagaatcgtaatttggtatcaactcaactatagtctctctcacctattctattcgagttcgatccggtttctctatttcgggtcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1278431 |
gtggtgctattttgcagaatcgtaatttggtatcaactcaactatagtctctctcccttattctattcgggttcgatccggtttctctatttcgggtcaa |
1278332 |
T |
 |
| Q |
208 |
accatcctacttcttcatttctaaatatttttaaagagta---ataaacaaatggatagtgttaacgtgtacccttaaggcaaccc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1278331 |
accatcctacttcttcatttctaaatatttttaaagagtactgataaacaaatgggtagtgttaacgtgtacccttaaggcaaccc |
1278246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University