View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_44 (Length: 351)
Name: NF9661A_low_44
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 40 - 176
Target Start/End: Original strand, 3116288 - 3116425
Alignment:
| Q |
40 |
gctcgtcaatagttgcaaaaacttcattctcacagttcagtaggttgcatgcatctaaaaaagcagtagatttcaccat-tctggtaccagagatgcgtc |
138 |
Q |
| |
|
|||| |||||||||||| |||| || | | ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
3116288 |
gctcttcaatagttgcagaaacctcgctgttacagttcagtaggttgcatacatctaaaaaagcagtagatttcaccatatctggtacaagagatgcgtc |
3116387 |
T |
|
| Q |
139 |
ttttacccctgctttgagattttccatcaaaacaagtg |
176 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3116388 |
ttttacctctgctttgagattttccatcaaaacaagtg |
3116425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University