View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661_low_14 (Length: 356)
Name: NF9661_low_14
Description: NF9661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 5 - 232
Target Start/End: Original strand, 22447065 - 22447292
Alignment:
| Q |
5 |
tgtacaatattaaactctaattataatcgcatgcctccatcaccatatcttcttgtttcaagttaaagtaattctactatcttaggtaatagnnnnnnnt |
104 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22447065 |
tgtacaatattaaactttaattataatcgcatgcctccatcaccatatcttcttgtttcaagttaaagtaattctactatcttaggtaatagaaaaaaat |
22447164 |
T |
 |
| Q |
105 |
atttgcaatcatagttatgttttatcactagcttcaaatctcataacaattcattatatgtagaaacgtggccaccgtcccatatggccctacctcattc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22447165 |
atttgcaatcatagttatgttttatcactagcttcaaatctcataacaattcattatatgtagaaacgtggccaccgtcccatatggccctacctcattc |
22447264 |
T |
 |
| Q |
205 |
catcactttcattgtctcaagcaattcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
22447265 |
catcactttcattgtctcaagcaattcc |
22447292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 299 - 356
Target Start/End: Original strand, 22447359 - 22447416
Alignment:
| Q |
299 |
gatgtaaactattgacatatatatagcaagacatatcacatatatgatgatgacacct |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22447359 |
gatgtaaactattgacatatatatagcaagacatatcacatatatgatgatgacacct |
22447416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University