View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661_low_29 (Length: 238)
Name: NF9661_low_29
Description: NF9661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 5 - 236
Target Start/End: Complemental strand, 39677185 - 39676959
Alignment:
| Q |
5 |
ggacaattttatagttgtatacttgtatttgggaccctcgtgctatatacaaaagcccaaattttctaatctaacattcatgacacacgacatgtgccat |
104 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39677185 |
ggacaattttatagttgtatacttgtgtttgggaacctctgtcgatatacaaaagcccaaagtttctaatctaacattcatgacacacgacatgt----- |
39677091 |
T |
 |
| Q |
105 |
tacatctagcaacgcttgcaggtgcgtgaagaccatgcgccgctatacaggctgtcgttgacgaaggcgacttcattgttgttctctccagctattcctc |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39677090 |
tacatctagcaactcttgcaggtgcgtgaagaccatgcaccgctatacaggctgtctttgacgaaggcgacttcattgttgttctctccagctattcctc |
39676991 |
T |
 |
| Q |
205 |
tttcttgtttggtattggcttgttggcctttg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39676990 |
tttcttgtttggtattggcttgttggcctttg |
39676959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University