View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661_low_36 (Length: 218)
Name: NF9661_low_36
Description: NF9661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 11 - 123
Target Start/End: Complemental strand, 43104638 - 43104524
Alignment:
| Q |
11 |
ataatactattatattcatatttatctattaaatcactttccttaaagaaaaccta--ttaaatcaccttgtagataattatgctttatattatgaatta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43104638 |
ataatactattatattcatatttatctattaaatcactttccttaaagaaaacctattttaaatcaccttgtagataattatgctttatattatgaatta |
43104539 |
T |
|
| Q |
109 |
tagatctatatttta |
123 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43104538 |
tagatctatatttta |
43104524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 147 - 201
Target Start/End: Complemental strand, 43104531 - 43104477
Alignment:
| Q |
147 |
atattttattcaccgtttctatatattgttgatgactaatgaacgtggcatgcct |
201 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43104531 |
atattttactcaccgtttctatatattgttgatgactaatgaacgtggcatgcct |
43104477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 144
Target Start/End: Complemental strand, 32188185 - 32188157
Alignment:
| Q |
116 |
atattttatgggaaatgctaaccgatgcc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32188185 |
atattttatgggaaatgctaaccgatgcc |
32188157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University