View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9662_1 (Length: 925)
Name: NF9662_1
Description: NF9662
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9662_1 |
 | |
|
| [»] scaffold0874 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0874 (Bit Score: 313; Significance: 1e-176; HSPs: 3)
Name: scaffold0874
Description:
Target: scaffold0874; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 333 - 1
Alignment:
| Q |
1 |
ccatcattggataaaaccctccttgcactccctttattcccgaaattgccatcaaaactcgctccattcctcgcatgtgaaggagaagaacgctctgcat |
100 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
333 |
ccatcgttggataaatccctccttgcactccctttattcccgaaattgccatcaaaactcgctccattcctcgcatgtgaaggagaagaacgctctgcat |
234 |
T |
|
| Q |
101 |
catccgacccatctacaccctttggaataaacttccttccattcccgtgcttcctcattctagcatcaatatttgatccattcctcctagaattcaaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
233 |
catccgacccatctacaccctttggaataaacttccttccattcccgtgcttcctcattctagcatcaatatttgatccattcctcccagaattcaaaga |
134 |
T |
|
| Q |
201 |
agaataaggatcttcattatctggccgatcaaaatccccaaatgaatacctactcccgttctttctcaatccaccacgaacattcaactcggtcttccta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
133 |
agaataaggatcttcattatctggccgatcaacatcccctaatgaatacctactcccgttctttctcaatccaccacgaacattcaactcggtcttccta |
34 |
T |
|
| Q |
301 |
gtactcaaatgagaagaacgctccccatcatgg |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33 |
gtactcaaatgagaagaacgctccccatcatgg |
1 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0874; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 376 - 450
Target Start/End: Complemental strand, 75 - 1
Alignment:
| Q |
376 |
ttctttctgaatccaccacgaacattcagttcactcctcccagtactcaaatgagaagaacgctccccatcatgg |
450 |
Q |
| |
|
|||||||| ||||||||||||||||||| || || ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
75 |
ttctttctcaatccaccacgaacattcaactcggtcttcctagtactcaaatgagaagaacgctccccatcatgg |
1 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0874; HSP #3
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 488 - 566
Target Start/End: Complemental strand, 80 - 2
Alignment:
| Q |
488 |
tcccgttctttttcaatacaccacgaacattcaattcactcctctcagcactcaaatgagaagaacgctccccatcatg |
566 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| || || || || |||||||||||||||||||||||||||||| |
|
|
| T |
80 |
tcccgttctttctcaatccaccacgaacattcaactcggtcttcctagtactcaaatgagaagaacgctccccatcatg |
2 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University