View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9663_high_10 (Length: 244)
Name: NF9663_high_10
Description: NF9663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9663_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 136 - 226
Target Start/End: Original strand, 42532692 - 42532784
Alignment:
| Q |
136 |
acacccttcgctccactttccactttagat--cttcaaagttagtgaaaaactcttttctttctttctctgtatgttgatgtgaatgtgtcac |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42532692 |
acacccttccctccactttccactttagatatcttcaaagttagtgaataagtcttttctttctttctctgtatgttgatgtgaatgtgtcac |
42532784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 42532557 - 42532614
Alignment:
| Q |
1 |
catatatttatacaaaattattatgattatttgttttccctttattttactatcatca |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42532557 |
catatatttatacaaaattattatgattatttgttttccctttattttactatcatca |
42532614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University