View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9663_high_14 (Length: 209)
Name: NF9663_high_14
Description: NF9663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9663_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 48482763 - 48482568
Alignment:
| Q |
1 |
tttttggagggcagcaaagtcatttatgtccataatcaatatatagatttttatggaagtaagcatttagttacatggctattacttccgctgctgggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482763 |
tttttggagggcagcaaagtcatttatgtccataatcaatatatagatttttatggaagtaagcatttagttacatggctattacttccgctgctgggaa |
48482664 |
T |
|
| Q |
101 |
aatatgttgatattgtttaaatgtacagttgcgttctacagtgaagaaggggactcaaataacacagacgctaatatattgtgcagttcacaggtt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48482663 |
aatatgttgatattgtttaaatgtacagttgcgttctacagtgaagaaggggactcaaataacacagacgctaatatattgcgcagttcacaggtt |
48482568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University