View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9663_low_35 (Length: 203)
Name: NF9663_low_35
Description: NF9663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9663_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 3866184 - 3866301
Alignment:
| Q |
17 |
cacagaaaaaacaaagcaatagataaattagaaaaactaaacaaactatttaaactcccttgatttaacaaatatgcatataaagaaaaacacgaaggag |
116 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3866184 |
cacagaaaaatcaaatcaatagataaattagaaaaactaaacaaactatttaaactcccttgatttaacaaatatgcatataaagaaaaacacgaaggag |
3866283 |
T |
 |
| Q |
117 |
tttagatgaacagtacct |
134 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3866284 |
tttagatgaacagtacct |
3866301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University