View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9663_low_35 (Length: 203)

Name: NF9663_low_35
Description: NF9663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9663_low_35
NF9663_low_35
[»] chr7 (1 HSPs)
chr7 (17-134)||(3866184-3866301)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 3866184 - 3866301
Alignment:
17 cacagaaaaaacaaagcaatagataaattagaaaaactaaacaaactatttaaactcccttgatttaacaaatatgcatataaagaaaaacacgaaggag 116  Q
    |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3866184 cacagaaaaatcaaatcaatagataaattagaaaaactaaacaaactatttaaactcccttgatttaacaaatatgcatataaagaaaaacacgaaggag 3866283  T
117 tttagatgaacagtacct 134  Q
    ||||||||||||||||||    
3866284 tttagatgaacagtacct 3866301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University