View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9664_high_8 (Length: 299)
Name: NF9664_high_8
Description: NF9664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9664_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 125 - 283
Target Start/End: Complemental strand, 12851257 - 12851101
Alignment:
| Q |
125 |
caaattagaaattaccatcactatatgttatgctcttcatgtgatttggttatcgattatttggactatttgaaagggtaaggatagccgtat--ttttg |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12851257 |
caaattagaaattaccatcactttatgttatgctcttcatgtgatttggttatcgattatttggactatttgaaagggtaaggatagccgtatttttttg |
12851158 |
T |
 |
| Q |
223 |
gcatacaacctattattataacatttgatttttattattgatcgatggatcaatctcatct |
283 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12851157 |
gcatacaacctattattacaacatttgatttttattatt----gatggatcaatctcatct |
12851101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 201
Target Start/End: Original strand, 23218108 - 23218157
Alignment:
| Q |
152 |
ttatgctcttcatgtgatttggttatcgattatttggactatttgaaagg |
201 |
Q |
| |
|
||||||||| |||||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
23218108 |
ttatgctctccatgtgatttggttgtcgactatttgggctatttgaaagg |
23218157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University