View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9664_low_20 (Length: 260)
Name: NF9664_low_20
Description: NF9664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9664_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 41472839 - 41472591
Alignment:
| Q |
1 |
atctttccatctatgctctttaactaatttctaagacaaatatggtgaataggaccaaaccatgatactttatgctttagaacttcagacattgagaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41472839 |
atctttccatctatgctctttaactaatttctaagacaaatacggtgaataggaccaaaccatgatactttatgctttagaacttcagacattgagaacg |
41472740 |
T |
|
| Q |
101 |
actttctgttttagaggtttagattttgagaatgtgtttgcatttatattaatcgattgattatgatgatgtctttgtaaatatagcaagattcaaatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
41472739 |
actttctgttttagaggtttagatattgagaatgtgtttgcatttatattaatcgattgattat---gatgtctttgtaaatatagcaagattcaaacgc |
41472643 |
T |
|
| Q |
201 |
gtacaagttgtgtcaatttagtagcaagagctccacgttgaagaattatcta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41472642 |
gtacaagttgtgtcaatttagtagcaagagctccacgttgaagaattatcta |
41472591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University