View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9664_low_26 (Length: 230)
Name: NF9664_low_26
Description: NF9664
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9664_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 8 - 193
Target Start/End: Original strand, 35096661 - 35096853
Alignment:
| Q |
8 |
tcaccctaaaatattcatta-tgttaatttaatgaataacaagttctcccttcatcaattttaaaaatttaaaattggattcatgcatgcatgcttcctt |
106 |
Q |
| |
|
|||||||||||||||||||| |||||||||| | |||| ||||||||| |||||||||||||||| | ||||||| |||||||||||| | ||| | |
|
|
| T |
35096661 |
tcaccctaaaatattcattagtgttaatttattttataataagttctcctttcatcaattttaaaattggaaaattgaattcatgcatgcttccttttat |
35096760 |
T |
|
| Q |
107 |
ttt--gcagcaagaacccgga----tatgatcgacttgctaaaggccagtctcccaaggtgatcaattattagagtttgatttatacataaat |
193 |
Q |
| |
|
| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||||| |||| |
|
|
| T |
35096761 |
atatggcagcaagaacccggaactgtatgatcgacttgctaaaggccagtctcccaaggtgattaattattagatctttatttatacaaaaat |
35096853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 150 - 214
Target Start/End: Original strand, 35102684 - 35102746
Alignment:
| Q |
150 |
tctcccaaggtgatcaattattagagtttgatttatacataaatgtatatgtatctctttttgtt |
214 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
35102684 |
tctccaaaggtgatcaattattagagtttgatttatacaaaaatg--tatgtatctctttttgtt |
35102746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 188
Target Start/End: Original strand, 35110012 - 35110075
Alignment:
| Q |
126 |
tatgatcgacttgctaaaggccagtctcccaaggtgatcaatta-ttagagtttgatttataca |
188 |
Q |
| |
|
|||||||||||||||||||| || || ||||||||||| ||||| || ||| |||||||||||| |
|
|
| T |
35110012 |
tatgatcgacttgctaaaggacaatcccccaaggtgattaattatttcgagcttgatttataca |
35110075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University