View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9665_high_1 (Length: 414)
Name: NF9665_high_1
Description: NF9665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9665_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 1 - 398
Target Start/End: Original strand, 52476361 - 52476758
Alignment:
| Q |
1 |
tgttgaatttttgttaggatttttcattttatcacaattaattactgacatgtgaagagttataatattgcagacgctatgttcttgcttctcgtcacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52476361 |
tgttgaatttttgttaggatttttcattttatcacaattaattactgacatgtgaagagttataatattgcagacgatatgttcttgcttctcgtcacaa |
52476460 |
T |
 |
| Q |
101 |
aagtatctttcatagctggccatttcctgagaaatatctgcaaatatgtctgaaccatggtctcaaagatattttgccaccatttgaatcactcaaaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476461 |
aagtatctttcatagctggccatttcctgagaaatatctgcaaatatgtctgaaccatggtctcaaagatattttgccaccatttgaatcactcaaaggt |
52476560 |
T |
 |
| Q |
201 |
tgttccaacttgttgcaacattcacgaaatgatcatgatactaaaaacttagctgagttttgcaaaactaaatcagttcaacaacatgtcattaagcaga |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476561 |
tgttccaaattgttgcaacattcacgaaatgatcatgatactaaaaacttagctgagttttgcaaaactaaatcagttcaacaacatgtcattaagcaga |
52476660 |
T |
 |
| Q |
301 |
accaacacaatattaaaaatgagtgtgatttgttgtcacatggaggagaaggatcatacaaattagtcactaaggaatcttcttcaaaacacgtatct |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476661 |
accaacacaatattaaaaatgagtgtgatttgttgtcacatggaggagaaggatcatacaaattagtcactaaggaatcttcttcaaaacacgtatct |
52476758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University