View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9666_low_12 (Length: 314)
Name: NF9666_low_12
Description: NF9666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9666_low_12 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 133 - 314
Target Start/End: Original strand, 47198939 - 47199120
Alignment:
| Q |
133 |
tttagtttaagcatttatcttttacgctcataattattttcattacattcagtgattgtacttcttcaattattataaatgaaatatttcatttggaatt |
232 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47198939 |
tttagcttaaccatttatcttttacgctcataattattttcattacattcagttattgtacttcttccattattataaatgaaatatttcatttggaatt |
47199038 |
T |
 |
| Q |
233 |
cttcatttgagatccacttttgtaacttttaggagaggtattttcattgagctacaaaaacttcttgaatctgtgctcctcc |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
47199039 |
cttcatttgagatccacttttgtaacttttaggagaggtattttcattgagctacaaaaacttcttgaatcagtgttcctcc |
47199120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 47198840 - 47198946
Alignment:
| Q |
1 |
atttaaagttacattgaaataagtgagttagaag---tattactttgcaatcttt-aaattagaaaaggatctttagtggattataatagatccttgcca |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47198840 |
atttaaagttacattgaaataagtgagttagaagaagtattactt-gcaatcttttaaattagaaaaggatctttagtagattataatagatccttgcca |
47198938 |
T |
 |
| Q |
97 |
tttagctt |
104 |
Q |
| |
|
|||||||| |
|
|
| T |
47198939 |
tttagctt |
47198946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University