View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9666_low_21 (Length: 245)
Name: NF9666_low_21
Description: NF9666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9666_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 26 - 240
Target Start/End: Complemental strand, 38501955 - 38501741
Alignment:
| Q |
26 |
taataatatctaggatgcagttcatattcaataaattgactagtttccgaactaatcctaagtatcaaatagagatatcccttacaaatcaaactttaat |
125 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38501955 |
taataatatctaggatgcggttcatattcaataaattgactagtttccgaactaatcctaagtatcaaatagagatatcccttacaaatcaaactttaat |
38501856 |
T |
 |
| Q |
126 |
ctttaataaaataaaggagatgatattgatgtaagatcgagaagcaacagtggtcctcttggctgaatgaagagtactcctggtatggcacgttggtaaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38501855 |
ctttaataaaataaaggagatgatattgatgtaagaccgagaagcaacagtggtcctcttggcagaatgaagagtactcctggtatggcacgttggtaaa |
38501756 |
T |
 |
| Q |
226 |
cctatgcttctcctc |
240 |
Q |
| |
|
|||||| | |||||| |
|
|
| T |
38501755 |
cctatggtgctcctc |
38501741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University