View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9667_high_20 (Length: 293)
Name: NF9667_high_20
Description: NF9667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9667_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 265
Target Start/End: Original strand, 41898664 - 41898917
Alignment:
| Q |
17 |
cttactaacttatcagaagtgtcagatcctataacagtgccgccatggtccttctctcttctcttcttccatccatccattcagttttcataaagcaacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41898664 |
cttactaacttatcagaagtgtcagatcctataacagtgccgccatggtccttctctcttctcttcttccatccatccattcagttttcataaagcaacc |
41898763 |
T |
 |
| Q |
117 |
aaactgggatctgttaacgtgacagtaatatacataacttattcagtaagtacgatccacgaccctttcattaattaatgttcacct-----aactaggt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41898764 |
aaactgggatctgttaacgtgacagtaatatacataacttattcagtaagtacgatccacgaccctttcattaattaatgttcacctaactaaactaggt |
41898863 |
T |
 |
| Q |
212 |
tcattgcagcagtaacacaaattaatgtaacaatagtcataatataaaagcttt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41898864 |
tcattgcagcagtaacacaaattaatgtaacaatagtaataatataaaagcttt |
41898917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University