View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9667_high_21 (Length: 288)
Name: NF9667_high_21
Description: NF9667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9667_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 14 - 277
Target Start/End: Original strand, 4263639 - 4263902
Alignment:
| Q |
14 |
atcaacaacaaatgaatataggtatacctgccacaactgaacagcagttacatcgtttgttccaccaacatatagaataagaatggctaagtagtgagga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4263639 |
atcaacaacaaatgaatataggtatacctgccacaactgaacagcagttacatcgtttgttccaccaacatatagaataagaatggctaagtagtgagga |
4263738 |
T |
|
| Q |
114 |
tttttgctgcgttcatggatcttaaacaagatattatagccattgtatttgcaagggattcttttatattctatatccaccacaccatatttaaaaagtt |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4263739 |
tttttgctgcgttcatggaccttaaacaagatattatagccattgtatttgcaagggattcttttatattctatatccaccacaccatatttaaaaagtt |
4263838 |
T |
|
| Q |
214 |
ctgcagatgcatcaccatttttgcccaattttgaatagccacgtgggctcatgatgaagtctgt |
277 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4263839 |
ccgcagatgcatcaccatttttgcccaattttgaatagccacgtgggctcatgataaagtctgt |
4263902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University