View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9667_high_32 (Length: 241)
Name: NF9667_high_32
Description: NF9667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9667_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 229
Target Start/End: Complemental strand, 48129663 - 48129437
Alignment:
| Q |
19 |
gggttagtaagatgagtcaataccaactttgatcacttctcttcaatgtagtctacgttgcactcattgtgtggttttgcccaattatgttggat----- |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48129663 |
gggttagtaagatgtgtcaataccaactttgatcacttctcttcaatgtagtctacgttgcactcattgtgtggttttgcccaattatgttggatatgct |
48129564 |
T |
|
| Q |
114 |
-----------ttgctacctgcttcatatttaaaccttactcatgagcatggcaaatcttccagagcctctcttgctcttctactaacttcaaacactac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48129563 |
gtcgtttggatttgctacctgcttcatatttaaaccttactcatgagcatggccaatcttccaaagcctctcttgctcttctactaacttcaaacactac |
48129464 |
T |
|
| Q |
203 |
ttgtaatacattgttccaacatctctg |
229 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
48129463 |
ttgtaatacattgttccaacatttctg |
48129437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 160 - 222
Target Start/End: Original strand, 48607968 - 48608030
Alignment:
| Q |
160 |
cttccagagcctctcttgctcttctactaacttcaaacactacttgtaatacattgttccaac |
222 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||| | ||| | ||||||| |||||||| |
|
|
| T |
48607968 |
cttccaaagcctctattgctcttctactaacttcaaacgccactgggaatacatcgttccaac |
48608030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University