View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9667_low_38 (Length: 302)
Name: NF9667_low_38
Description: NF9667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9667_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 11 - 288
Target Start/End: Original strand, 6314972 - 6315246
Alignment:
| Q |
11 |
tgttgattatgttatgttaaatataaattcgttaattattaattaattttttgtgtgtttttagggggtgtaggtagtaaaaatgtggtggttcctgaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6314972 |
tgttgattatgttatgttaaatataaattcgttaattattaattaattttttgtgtgtttttagggggtg---gtagtaaaaatgtggtggttcctgaaa |
6315068 |
T |
|
| Q |
111 |
gagtggtttatgcttggaatcggaaggtggaagaaggtatgattagaggttacatgcagcagaaaaatcgtttttatggaacttcaaattttgaaaatgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315069 |
gagtggtttatgcttggaatcggaaggtggaagaaggtatgattagaggttacatgcagcagaaaaatcgtttttatggaacttcaaattttgaaaatgg |
6315168 |
T |
|
| Q |
211 |
ttagtactgtaattaattaatttgcataaagtttttctttattgatttggggattttatgatttgacagtgatgtgtg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315169 |
ttagtactgtaattaattaatttgcataaagtttttctttattgatttggggattttatgatttgacagtgatgtgtg |
6315246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University