View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9667_low_39 (Length: 299)
Name: NF9667_low_39
Description: NF9667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9667_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 293
Target Start/End: Original strand, 45703115 - 45703389
Alignment:
| Q |
19 |
cttctttgtctcttgtctcactagtggaaggctccaactcaaactatgttttcttctactttgtttctgagtgaatattcaataggtccttgcacttcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45703115 |
cttctttgtctcttgtctcactagtggaaggctccaactcaaactaagttttcttctactttgtttctgagtgaatattcagtaggtccttgcacttcat |
45703214 |
T |
 |
| Q |
119 |
ccacatattggtctcatcaaaaataatatttatgcttataataaatcctgatccttctctttttccattatcagcaacttgtaattcttgctcgttcaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45703215 |
ccacatattggtctcatcaaaaataatatttatgcttataataaatcctgatccttctctttttccattatcagcaacttgtaattcttgctcgttcaat |
45703314 |
T |
 |
| Q |
219 |
ataaccaaattaaagaaggcacgttttacaaccctaccatcaatcttttcttgcttgatatgcatgaacaccaaa |
293 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45703315 |
ataaccaaattaaagaagacacgttttacaaccctaccatcaatcttttcttgcttgatatgcatgaacgccaaa |
45703389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 101 - 173
Target Start/End: Complemental strand, 15314821 - 15314749
Alignment:
| Q |
101 |
taggtccttgcacttcatccacatattggtctcatcaaaaataatatttatgcttataataaatcctgatcct |
173 |
Q |
| |
|
|||||| ||||||||||||| ||| | ||||||||||||||||| || |||||||||||||| ||||||| |
|
|
| T |
15314821 |
taggtctttgcacttcatccccatgtgggtctcatcaaaaataacatccctgcttataataaattttgatcct |
15314749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University