View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9667_low_40 (Length: 299)
Name: NF9667_low_40
Description: NF9667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9667_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 8 - 281
Target Start/End: Original strand, 43963174 - 43963447
Alignment:
| Q |
8 |
ttggtgttttctgtgaacttagttcgaaggatccgagatcgtatcttccgttggcacccgagttttataggattttagttgattctaagaataattgggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43963174 |
ttggtgttttctgtgaacttagttcgaaggatccgagatcgtatcttccattggcacccgagttttataggattttagttgattctaagaataattgggt |
43963273 |
T |
 |
| Q |
108 |
gcttattaaggttttgaagatttttgctaggttggctcctttggaacctaggttagggaagaggattgttgaacctatttgtgagcatattagaagatct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43963274 |
gcttattaaggttttgaagatttttgctaggttggctcctttggaacctaggttagggaagaggattgttgaacctatttgtgagcatattagaagatct |
43963373 |
T |
 |
| Q |
208 |
ggagcgaaatcgcttgtttttgagtgtgtgaggactgtaattactagtttgagtgatcatgagtctgctgttaa |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43963374 |
ggagcgaaatcgcttgtttttgagtgtgtgaggactgtgattactagtttgagtgatcatgagtctgctgttaa |
43963447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University