View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9667_low_53 (Length: 268)
Name: NF9667_low_53
Description: NF9667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9667_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 116 - 257
Target Start/End: Complemental strand, 7884892 - 7884751
Alignment:
| Q |
116 |
ttttcttgagttaccatgttagagctacgaagagaaaaaagtaacctagcaaggcaataaaagcatcggcttgtcgagccatttcggccttgcattggtg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
7884892 |
ttttcttgagttaccatgttagagctacgaagagaaaaaagtaacctggcaaggcaataaaagcatcggcctgtcgagccatttcggccttgcgttggtg |
7884793 |
T |
|
| Q |
216 |
catgtccgatacagcccgaacttcacctacactctcccctat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7884792 |
catgtccgatacagcccgaacttcacctacactctcccctat |
7884751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 20 - 119
Target Start/End: Complemental strand, 7885151 - 7885052
Alignment:
| Q |
20 |
aggtgatcacttctaatagttcttccaaggtgtcatatccacctataagaataggaaaattattgttataaaaactgcaatgagataaaacgtacgtttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7885151 |
aggtgatcacttctaatagttcttccaaggtgtcatatccacctataagaataggaaaattattgttataaaaactgcaatgagataaaacgtacgtttt |
7885052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 166 - 230
Target Start/End: Complemental strand, 53033270 - 53033206
Alignment:
| Q |
166 |
aaggcaataaaagcatcggcttgtcgagccatttcggccttgcattggtgcatgtccgatacagc |
230 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
53033270 |
aaggcaataaatgcatcagcttgtcgagccatttcggctttgcgttggtgcatgtccgatacagc |
53033206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University