View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9667_low_66 (Length: 241)
Name: NF9667_low_66
Description: NF9667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9667_low_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 177
Target Start/End: Original strand, 36638353 - 36638513
Alignment:
| Q |
17 |
ttatttccataccaacaagtatgagccaacaaacgaaacatcttattttactacatagggatttgctgcatccagcaatccactccatcacgcatccaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36638353 |
ttatttccataccaacaagtatgagccaacaaacgaaacatcttattttactacatagggatttgctgcatccagcaatccactccatcacgcatccaga |
36638452 |
T |
 |
| Q |
117 |
gaagttgaagattgctggatcaagacaggatggtccatatttcaatgcgtattttgatttt |
177 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
36638453 |
gaagttgaagattgctggatcaagaccggacggtccatatttcaatgcgtattttgatttt |
36638513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 36638529 - 36638578
Alignment:
| Q |
193 |
aatttatgttcttaaaatctagat-gtctgatcttgattcaacggtcacc |
241 |
Q |
| |
|
|||||| || ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36638529 |
aatttacgtgcttaaaatctagacagtctgatcttgattcaacggtcacc |
36638578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University