View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9667_low_84 (Length: 216)
Name: NF9667_low_84
Description: NF9667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9667_low_84 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 11 - 200
Target Start/End: Complemental strand, 4355362 - 4355172
Alignment:
| Q |
11 |
aagcaaaggaagagagaaaggaagccaaagttaagaaaggtagcaatatttttcggagaggggc-agctatggtttcaatttgaccagtaagtggaatta |
109 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
4355362 |
aagcaaaagaagagagaaagaaagccaaagttaagaaaggtagcaatattttttggagaggggccagctatggtttcagtttgacaagttagtggaatta |
4355263 |
T |
 |
| Q |
110 |
ttgtatgaagacaatgtagtggtgggtcttctccttaaagcattatttaactttaaaacaaatcggggtcaccaatcacacacaatcaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4355262 |
ttgtatgaagacaatgtagtggtgggtcttctccttaaagcattatttaactttaaaacaaatcggggtcaccaatcacacacaatcaaaa |
4355172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University