View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9668_low_3 (Length: 312)
Name: NF9668_low_3
Description: NF9668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9668_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 35164063 - 35163808
Alignment:
| Q |
1 |
cgtggttaacggcgatgccgataaaaattccgtcagccagttcagttacttgaacggccatgatcggagagaaatgaccggtgtaactgactttccggtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35164063 |
cgtggttaacggcgatgccgataaaaattccgtcagcgagttcagttacttgaacggccatgatcggagagaaatgaccggtgtaactgactttccggtc |
35163964 |
T |
|
| Q |
101 |
aaaagtgaaaaactctttgaatgattcatgaacatcggttgttgataagaggtcagtgatgtaaagtgaggtggaagttgcagtgatgaaatcgacgccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163963 |
aaaagtgaaaaactctttgaatgattcatgaacatcggttgttgataagaggtcagtgatgtaaagtgaggtggaagttgcagtgatgaaatcgacgccg |
35163864 |
T |
|
| Q |
201 |
gcgtcgttgcaagtcaggtaaacatagccctcagagtcggtggttaaacgaccggc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163863 |
gcgtcgttgcaagtcaggtaaacatagccctcagagtcggtggttaaacgaccggc |
35163808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University