View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9668_low_8 (Length: 260)
Name: NF9668_low_8
Description: NF9668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9668_low_8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 260
Target Start/End: Original strand, 32789735 - 32789990
Alignment:
| Q |
11 |
caaaggacaatggatggagaatcaatagaaagaaatgaaaagnnnnnnnn--gttttatttaaagaatgaaaatagga---gactctcctctaatggtat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32789735 |
caaaggacaatggatggagaatcaatagaaagaaatgaaaagaaaaaaaaaagttttatttaaagaatgaaaataggaggagactctcctctaatggtat |
32789834 |
T |
 |
| Q |
106 |
ccctttcacaaagggctgctactttatccattcaaaatacaacaaacaaatgtaccagatccctcg-tcatccttatttatcctatttatattttataca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
32789835 |
ccctttcacaaagggctgctactttatccattcaaaatacaacaaacaaatgtaccagatccctcgctcatccttatttatcctatttatgttttataca |
32789934 |
T |
 |
| Q |
205 |
cgataccctctcaaactacttaacttctcttactagcttcccttctaagttctaac |
260 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789935 |
cgatatcctctcaaactactaaacttctcttactagcttcccttctaagttctaac |
32789990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University