View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9668_low_9 (Length: 257)
Name: NF9668_low_9
Description: NF9668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9668_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 50411159 - 50410988
Alignment:
| Q |
1 |
ttgtgtcgaggatgttgttcatcgtgaaggtttggaaaataaccaggaagagtgcattgatcaggaacaacaatttgtgagttctgatgcacattggggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
50411159 |
ttgtgtcgaggatgttgttcatcgtgaaggtttggaaaataaccaggaagagtgcattgatcaggaacaacaatttgtgagttctgatgcacattgtggt |
50411060 |
T |
|
| Q |
101 |
cagagtagtaaaatctgtgtcagaggcggttacggttcacaattttttcgttctaaggttcgtattctgctt |
172 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50411059 |
cagagtagtaaaatctgcgtcagaggcggttacggttcacaattttttcgttctaaggttcgtattctgctt |
50410988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University