View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9669_high_13 (Length: 288)
Name: NF9669_high_13
Description: NF9669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9669_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 39289007 - 39288737
Alignment:
| Q |
1 |
tcctttttggtggttctgtttttggtagtaccttaactttttcttggttattttctatgtcttgaacttcagctagaaattcatactcaacatcatcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39289007 |
tcctttttggtggttctgtttttggtagtaccttaactttttcttggttattttctatgtcttgaacttcagctagaaattcatactcaacatcatcagc |
39288908 |
T |
|
| Q |
101 |
atcaatgttgatgtcacaaaaatgactacttgctcgactccgagttggactaataccttgactctgaggaagaattttgaaagaattgtttcttgtccga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39288907 |
atcaatgttgatgtcacaaaaatgactacttgctcgactccgagttggactaataccttgactctgaggaagaattttgaaagaattgtttcttgtccga |
39288808 |
T |
|
| Q |
201 |
ggaatccaaagccatgttccagttctctctggctttgttggtgattcaattgcaaaagggcttcttctgtt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39288807 |
ggaatccaaagccatgttccagttctctctggctttgttggtgattcaattgcaaaagggcttcttctgtt |
39288737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 21 - 139
Target Start/End: Complemental strand, 39295870 - 39295752
Alignment:
| Q |
21 |
tttggtagtaccttaactttttcttggttattttctatgtcttgaacttcagctagaaattcatactcaacatcatcagcatcaatgttgatgtcacaaa |
120 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| ||||| ||||||| ||||||||||||||||||| |||| ||||||||||||||||||||||| | |
|
|
| T |
39295870 |
tttggtagtacctcaactttctcttggttattttccatgtcctgaacttgagctagaaattcatactcatcatcgtcagcatcaatgttgatgtcacaga |
39295771 |
T |
|
| Q |
121 |
aatgactacttgctcgact |
139 |
Q |
| |
|
| |||||||| |||||||| |
|
|
| T |
39295770 |
agtgactactagctcgact |
39295752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 182 - 271
Target Start/End: Complemental strand, 39295724 - 39295632
Alignment:
| Q |
182 |
agaattgtttcttgtcc---gaggaatccaaagccatgttccagttctctctggctttgttggtgattcaattgcaaaagggcttcttctgtt |
271 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| | | |||||| |||||||| ||||||||||||||||||||| ||| |||| |
|
|
| T |
39295724 |
agaattgtttcttgtccatggaggaatccaaagccatgttcctgctttctctgtctttgttgttgattcaattgcaaaagggctgcttttgtt |
39295632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University