View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9669_high_14 (Length: 268)

Name: NF9669_high_14
Description: NF9669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9669_high_14
NF9669_high_14
[»] chr4 (1 HSPs)
chr4 (19-197)||(6878044-6878222)


Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 6878222 - 6878044
Alignment:
19 ctcatcctgttcttcattaatgtatgctccgaaaacggagcatattcttgcatacacaatgcacacaagccttgccatgatcccaaccgttttgtcaaat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6878222 ctcatcctgttcttcattaatgtatgctccgaaaacggagcatattcttgcatacacaatgcacacaagccttgccatgatcccaaccgttttgtcaaat 6878123  T
119 gtttgtttccataacgatgtttccttgaaattttgcacttgctttctttgaaacactaatttctcgttgaaatattcca 197  Q
    |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||    
6878122 gtttgtttccataatgatgtttccttaaaattttgcacttgctttctttgaaacactaatttctcattgaaatattcca 6878044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University