View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9669_high_17 (Length: 243)
Name: NF9669_high_17
Description: NF9669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9669_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 86 - 226
Target Start/End: Complemental strand, 11616114 - 11615977
Alignment:
| Q |
86 |
cgtgggttgaatttacataaggtttattgattaacaatattagggtttgatttaagtatatttcttcgannnnnnnnnnnnnnaatgtatcaggtgatag |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||| |
|
|
| T |
11616114 |
cgtgggttgaatttacataaggtttattgattaacaatattagggtttgatttaagtatatttctttga---tttttttttttaatgtatcaggtgttag |
11616018 |
T |
|
| Q |
186 |
atttcaagaaaaatcaaatgcatcgtgttaacttttggctt |
226 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
11616017 |
attttaaggaaaatcaaatgcatcgtgctaacttttggctt |
11615977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 11616160 - 11616115
Alignment:
| Q |
13 |
ataattcttatttgatgaacatatgcatagatcttgagtggattaa |
58 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11616160 |
ataattcttatttgatgaaaatatgcatagatcttgagtggattaa |
11616115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 169 - 227
Target Start/End: Original strand, 8671695 - 8671753
Alignment:
| Q |
169 |
aatgtatcaggtgatagatttcaagaaaaatcaaatgcatcgtgttaacttttggcttg |
227 |
Q |
| |
|
||||||||||||| |||||||| || |||||||||||||||||| ||| | |||||||| |
|
|
| T |
8671695 |
aatgtatcaggtgctagatttctaggaaaatcaaatgcatcgtgctaaatattggcttg |
8671753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 169 - 227
Target Start/End: Complemental strand, 8715396 - 8715338
Alignment:
| Q |
169 |
aatgtatcaggtgatagatttcaagaaaaatcaaatgcatcgtgttaacttttggcttg |
227 |
Q |
| |
|
||||||||| ||| |||||||| || |||||||||||||||||||||| ||||| |||| |
|
|
| T |
8715396 |
aatgtatcaagtgctagatttctaggaaaatcaaatgcatcgtgttaaattttgtcttg |
8715338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 35078875 - 35078918
Alignment:
| Q |
169 |
aatgtatcaggtgatagatttcaagaaaaatcaaatgcatcgtg |
212 |
Q |
| |
|
||||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
35078875 |
aatgtatcaggtgctagatttctaggaaaatcaaatgcatcgtg |
35078918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University