View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9669_low_17 (Length: 391)
Name: NF9669_low_17
Description: NF9669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9669_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 14 - 374
Target Start/End: Complemental strand, 54076214 - 54075854
Alignment:
| Q |
14 |
aacctgtgtgtccaatctttaggttcaacagcctcaaatcctaacccaggtgtcctatcttgcgagtttgggttcatagcttgtctccaatccacaacat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076214 |
aacctgtgtgtccaatctttaggttcaacagcctcaaatcctaacccaggtgtcctatcttgcgagtttgggttcatagcttgtctccaatccacaacat |
54076115 |
T |
 |
| Q |
114 |
aagcagacactctccttctaaatttgctcttaaactcaacccacgcttggtacttataatgattcaccaaaccctcttcgggaccaagttgtttcgatct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076114 |
aagcagacactctccttctaaatttgctcttaaactcaacccacgcttggtacttatagtgattcaccaaaccctcttcgggaccaagttgtttcgatct |
54076015 |
T |
 |
| Q |
214 |
aaacccttgtttctcattcacttgaaaatgatgtatcacattccacaaacttctatcaactgcttctaccaacacaattgatttgtgtctttgttccact |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076014 |
aaacccttgtttctcattcacttgaaaatgatgtatcacattccacaaacttctatcaactgcttctaccaacacaattgatttgtgtctttgttccact |
54075915 |
T |
 |
| Q |
314 |
ttcctccgacacgtgtacccttgtgttaccccttctttcgggtgttgtctttgacctgatg |
374 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54075914 |
ttcctccgacacgtgtacccctgtgttaccccttctttcgggtgttgtcgttgacctgatg |
54075854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University