View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9669_low_22 (Length: 359)
Name: NF9669_low_22
Description: NF9669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9669_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 344
Target Start/End: Original strand, 28550017 - 28550349
Alignment:
| Q |
1 |
gttttgcaagcttgctttacggttatgttttcaattcatatcgcattcgaaaagggtggaatattaatagcaaattaatggctttaataggagttaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550017 |
gttttgcaagcttgctttacggttatgttttcaactcatattgcattcgaaaagggtggaatgttaatagcaaattaatggctttaataggagttaattt |
28550116 |
T |
 |
| Q |
101 |
tatgcaaaaattacacgccgccatctcactttccatcgttgaggtattcctgattttagtgaacctaagtaatgtggcacatcttcaatgtttgcctatg |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550117 |
tatgcaaaaattacacgctgccatctcactttccatcgttgaggtattcctgattttagtgaacctaagtaatgtggcacatcttcaatgtttgcctatg |
28550216 |
T |
 |
| Q |
201 |
cttaatttcttagacnnnnnnnnatcactaccaaagaacctgccgcctgaatgctttgttaggaagactttcga--cacaaggagccgatcgggctgtcg |
298 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| || | |||| |||||||||||||||||||||||| |
|
|
| T |
28550217 |
cttaatttcttagacttttttttatcactaccaaagaacctgccgcctgaatcct-------------tatcgaaccacaaggagccgatcgggctgtcg |
28550303 |
T |
 |
| Q |
299 |
aacccttatcaaaccacaaccacgttttgataccactagatgtcca |
344 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
28550304 |
aacccttatcgaaccacaaccacgttttgataccactagttgtcca |
28550349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University