View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9669_low_34 (Length: 268)
Name: NF9669_low_34
Description: NF9669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9669_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 6878222 - 6878044
Alignment:
| Q |
19 |
ctcatcctgttcttcattaatgtatgctccgaaaacggagcatattcttgcatacacaatgcacacaagccttgccatgatcccaaccgttttgtcaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878222 |
ctcatcctgttcttcattaatgtatgctccgaaaacggagcatattcttgcatacacaatgcacacaagccttgccatgatcccaaccgttttgtcaaat |
6878123 |
T |
|
| Q |
119 |
gtttgtttccataacgatgtttccttgaaattttgcacttgctttctttgaaacactaatttctcgttgaaatattcca |
197 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6878122 |
gtttgtttccataatgatgtttccttaaaattttgcacttgctttctttgaaacactaatttctcattgaaatattcca |
6878044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University