View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9669_low_36 (Length: 265)
Name: NF9669_low_36
Description: NF9669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9669_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 62 - 258
Target Start/End: Original strand, 34577280 - 34577484
Alignment:
| Q |
62 |
taaatgggtctaaaaacgattgaaaactttaaatgaaaatagatcacatcttctaaaagtaaatggaaaattactgatctctttctatgcttaaaaattg |
161 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
34577280 |
taaatgggtctaaaaacaattgaaaactttaaatgaaaatagatcacatcttctaaaagtaaatggacaattactgatcactttctatgcttaaaaattg |
34577379 |
T |
 |
| Q |
162 |
agctttcatgcattgattttttctattaaattctcattttgactggtttttacaccat--------at-gtttcttgaacatttattatctgtcctacct |
252 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
34577380 |
agctttcatgcattgattttttctatt-aattctcattttgactggtttttacaccattgctaccaatggtttcttgaacatttattatctgtcctacca |
34577478 |
T |
 |
| Q |
253 |
atgcta |
258 |
Q |
| |
|
|||||| |
|
|
| T |
34577479 |
atgcta |
34577484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 34577183 - 34577230
Alignment:
| Q |
18 |
ataatgatcatcgaaaacttacgcactatttttatcgttaagagtaaa |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34577183 |
ataatgatcatcgaaaacttacgcactatttttatcgaaaagagtaaa |
34577230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University