View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9669_low_39 (Length: 250)
Name: NF9669_low_39
Description: NF9669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9669_low_39 |
 |  |
|
| [»] scaffold0085 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 27 - 239
Target Start/End: Complemental strand, 45949 - 45737
Alignment:
| Q |
27 |
tatatcattgattattatgatttgttaattacatttatagcatcctttagagcaccaaaacttctaatgaagtcatgtctggtatttgacatctgttagt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45949 |
tatatcattgattattatgatttgttaattacatttatagcatcctttagagcaccaaaacttctaatgaagtcatgtctggtatttgacatctgttagt |
45850 |
T |
 |
| Q |
127 |
gtctaacatcaacacaacactgacaggtataattacattttattatgctannnnnnnaaattattatcggtctcgatgtgtcactatgtgtcactgttgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45849 |
gtctaacatcaacacaacactgacaggtataattacattttattatgctatttttttaaattattatcggtctcgatgtgtcactatgtgtcactgttgt |
45750 |
T |
 |
| Q |
227 |
gtttggtgtctct |
239 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45749 |
gtttggtgtctct |
45737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 46063 - 46007
Alignment:
| Q |
1 |
tcgcatttcatcttcatagtttaacttatatcattgattattatgatttgttaatta |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46063 |
tcgcatttcatcttcatagtttaacttatatcattgattattatgatttgttaatta |
46007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University