View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9669_low_44 (Length: 224)
Name: NF9669_low_44
Description: NF9669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9669_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 47778763 - 47778561
Alignment:
| Q |
14 |
tttggtgttagagatgtttttgattggttttatgctaggtgggttttgattcgtgttgggtatcttgctcctcctttgcaatttctcacaaatgcttgta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47778763 |
tttggtgttagagatgtttttgattggttttatgctagatgggttttaattcgtgttgggtatcttgctcctcctttgcaatttctcacaaatgcttgta |
47778664 |
T |
|
| Q |
114 |
ttgtgctctttcttattcagagtatagatagattggttctttgtttaggttgtttttggatcaagtttaagaaaattaaacctgttccaaaaggtggtga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47778663 |
ttgtgctctttcttattcagagtatagatagattggttctttgtttaggttgtttttggatcaagtttaagaaaattaaacctgttccaaaaggtggtga |
47778564 |
T |
|
| Q |
214 |
tgt |
216 |
Q |
| |
|
||| |
|
|
| T |
47778563 |
tgt |
47778561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University