View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9669_low_47 (Length: 206)
Name: NF9669_low_47
Description: NF9669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9669_low_47 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 44 - 206
Target Start/End: Complemental strand, 46279 - 46117
Alignment:
| Q |
44 |
aatcatcataatagtttcattattattgttcaattaggtcaacgaagaaatcgaagctcatattcaggtcacacgcgagatcgaatccagcatcgtcaaa |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46279 |
aatcatcataatagtttcattattattgttcaattaggtcaacgaagaaatcgaagctcatattcaggtcacacgcgagatcgaatccagcatcgtcaga |
46180 |
T |
 |
| Q |
144 |
tgcgaagagatggagaatcattttgcaactaaggaagctgaattgatcgaaatctgtggcgtt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46179 |
tgcgaagagatggagaatcattttgcaactaaggaagctgaattgatcggaatctgtggcgtt |
46117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University