View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9670_high_18 (Length: 231)
Name: NF9670_high_18
Description: NF9670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9670_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 219
Target Start/End: Complemental strand, 6863868 - 6863669
Alignment:
| Q |
20 |
gttggaccattcgctcattcgcagcctagccaaatcacacgaggttttgatcactgtggaagaaggatcaataggaggatttggttctcatgttgctcag |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6863868 |
gttggaccattcactcattcgcagcctagccaaatcacacgaggttttgatcactgtggaagaaggatcaataggaggatttggttctcatgttgctcag |
6863769 |
T |
 |
| Q |
120 |
ttcatggcccttgatggtcttcttgatggaaaattgaaggtatgaatccttttcttttttaatttggcctaaattatttggatttcttatgtagtataat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6863768 |
ttcatggcccttgatggtcttcttgatggaaaattgaaggtatgaatccttttcttttttaatttggcctaaattatttgcatttcttatgtagtataat |
6863669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 36 - 161
Target Start/End: Original strand, 49148644 - 49148769
Alignment:
| Q |
36 |
attcgcagcctagccaaatcacacgaggttttgatcactgtggaagaaggatcaataggaggatttggttctcatgttgctcagttcatggcccttgatg |
135 |
Q |
| |
|
|||||||| || |||||||||||||||||| ||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49148644 |
attcgcagtctggccaaatcacacgaggttctgatcaccgtagaagaaggatcaattggaggatttggttctcatgttgctcagttcatggcccttgatg |
49148743 |
T |
 |
| Q |
136 |
gtcttcttgatggaaaattgaaggta |
161 |
Q |
| |
|
| || | |||||||| ||||||||| |
|
|
| T |
49148744 |
gcctcttagatggaaatttgaaggta |
49148769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 81 - 142
Target Start/End: Complemental strand, 49712716 - 49712655
Alignment:
| Q |
81 |
gaaggatcaataggaggatttggttctcatgttgctcagttcatggcccttgatggtcttct |
142 |
Q |
| |
|
|||||||| || |||||||||||||| ||||||||||| || || || |||||||| ||||| |
|
|
| T |
49712716 |
gaaggatctattggaggatttggttcccatgttgctcaatttattgctcttgatggacttct |
49712655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University