View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9670_high_8 (Length: 369)
Name: NF9670_high_8
Description: NF9670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9670_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 5e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 182 - 366
Target Start/End: Complemental strand, 38707021 - 38706837
Alignment:
| Q |
182 |
acaagcttgatagttccgttttcattagaataatactggtagatagatcatggtttaggggttgatctctttgtggtctcagcggctgttggtccttact |
281 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38707021 |
acaagcttgatagctccattttcattagaataatactggtagatagatcatggtttaggg-ttgatctctttgtggtctcagcggctgttggtccttact |
38706923 |
T |
|
| Q |
282 |
gataggagggaattgttgtggattatttgggttctcttagggtgggctaaggttt----ggagtctttaagttgggtgtttttgtctct |
366 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38706922 |
gataggagggaattgttgtgg---atttgggttcccttagggtgggctaaggtttggtcggagtctttaagttgggtgtttttgtctct |
38706837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 18 - 120
Target Start/End: Complemental strand, 38707225 - 38707123
Alignment:
| Q |
18 |
aggagtaataaataaaagagcacaaagttagccaaaccgttactctataaaaggaatttaccctaacagcttagcagctttgccaacaagagaaaagaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38707225 |
aggagtaataaataaaagagcacaaagttagccaaaccgttactctataaaaggaatttaccctaacagcttagcagctttgccaacaagagaaaagaaa |
38707126 |
T |
|
| Q |
118 |
cag |
120 |
Q |
| |
|
||| |
|
|
| T |
38707125 |
cag |
38707123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University