View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9670_low_32 (Length: 271)
Name: NF9670_low_32
Description: NF9670
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9670_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 27 - 252
Target Start/End: Original strand, 34590783 - 34591008
Alignment:
| Q |
27 |
aaatgatgaaaggcaacctgaaattgatgagcaaaaaatgttgtagtatctgattctgaaaatagcaatgatgaaaattaggatttggggaaaaggctaa |
126 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34590783 |
aaataatgaaaggcaacctgaaattgatgagcaaaaaatgttatagcatctgattctgaaaatagcaatgatgaaaattaggatttggggaaaaggctaa |
34590882 |
T |
 |
| Q |
127 |
gcagaagccctgcatatctggatgattatgacactacaaaagctactaaagcacaatctctccataatcttgttgtattcagctccagtgaagatccaac |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34590883 |
gcagaagccctgcatatctggatgattatgacactacaaaagctactaaagcacaatctctccataatcttgttgtattcagctccagtgaagatccaac |
34590982 |
T |
 |
| Q |
227 |
atcgtatgaataatttgctaagcatg |
252 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
34590983 |
atcatatgaataatttgctaagcatg |
34591008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 34590736 - 34590767
Alignment:
| Q |
1 |
acctacaacgcaagcaatcatagtgaaaatga |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34590736 |
acctacaacgcaagcaatcatagtgaaaatga |
34590767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University