View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9671_low_12 (Length: 259)
Name: NF9671_low_12
Description: NF9671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9671_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 1610258 - 1610511
Alignment:
| Q |
1 |
caagaatcctggttcaagagctgatacaactaatgaaacttgttgcttagttttgagagtctcgatcagcttctgcacaacacgagtgttgtgggaagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1610258 |
caagaatcctggttcaagagctgatacgactaatgaaacttgttgcttagttttgagagtctcgatcagcttctgcacaacacgagtgctgtgggaagga |
1610357 |
T |
|
| Q |
101 |
gagaacaatgaggtcaagttcagcattagataataagtacattatttcatattaattataaaatagttgcatgactacccgtgagtatttaacgagattc |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1610358 |
gagaacaatgaggtcaagttcaacattagataataagtacattatttcatattagttataaaatagttgcatgactacccgtgagtatttaacgagattc |
1610457 |
T |
|
| Q |
201 |
tgacaagctgccccggctcctggataaccatcagtatgatctgcatcctttgct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1610458 |
tgacaagctgccccggctcctggataaccatcagtatgatctgcatcctctgct |
1610511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University