View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9671_low_6 (Length: 417)
Name: NF9671_low_6
Description: NF9671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9671_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 10 - 414
Target Start/End: Original strand, 14526884 - 14527288
Alignment:
| Q |
10 |
gagcagagacagttatgataacatgtggccatcaagtagagcataacacaagcatctttgttccgaattttgttgcgactatggagaagattagcgagca |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14526884 |
gagcaaagacagttatgataacatgtggccatcaagtagagcataacacaagcatctttgttccgaattttgttgcaactatggagaagattagcgagca |
14526983 |
T |
 |
| Q |
110 |
gatgcgcagtaccggcttcggcacagcagttacagggacaggacctgatgataactatggcctagcacaatgctatggagatctttcattacttgactgt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14526984 |
gatgcgcagtaccggcttcggcacagcagttacagggacaggacctgatgataactatggcctagcacaatgctatggatatctttcattacttgactgt |
14527083 |
T |
 |
| Q |
210 |
gtgttgtgttatgctgaggcgcgcacggttcttcctcagtgcttcccttataactccggtcacatttaccttgatggttgcttcacgaggtctgcgaact |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
14527084 |
gtgttgtgttatgctgaggcgcgcacggttcttcctcagtgcttcccttataactccggtcgcatttaccttgatggttgcttcatgaggtctgtgaact |
14527183 |
T |
 |
| Q |
310 |
atagnnnnnnnagtgagtatacaggaaaagaagatagaactgtgtgtgggaacacaactacgaagagctcgggttttcacgcagcagcgaaggaggcagt |
409 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14527184 |
atagtttttttagtgagtatacaggaaaagaagatagaactgtgtgtgggaacacaactaagaagagctcgggttttcaagcagcagcgaaggaggcagt |
14527283 |
T |
 |
| Q |
410 |
gttaa |
414 |
Q |
| |
|
||||| |
|
|
| T |
14527284 |
gttaa |
14527288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University