View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9671_low_8 (Length: 317)
Name: NF9671_low_8
Description: NF9671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9671_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 25 - 202
Target Start/End: Original strand, 529026 - 529203
Alignment:
| Q |
25 |
catttggtttacatgcatactaaaagtatatgaaatttccctccatttatattcttacttgttttcagaatcaatggtcaaatatgttttgcggcattgt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
529026 |
catttggtttacatgcatactaaaagtatatgaaatttccctccatttatattcttacttgttttcagaatcaatggtcaaatatgttttgcggcattgt |
529125 |
T |
|
| Q |
125 |
ttctagagcagcaacacttgaagtcctttcaactggagtgggaggtaactacgatggagccttgcaagtggtaagtac |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
529126 |
ttctagagcagcaacacttgaagtcctttcaactggagtgggaggtaactacgatggagccttgcaagtggtaagtac |
529203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 265 - 304
Target Start/End: Original strand, 529291 - 529330
Alignment:
| Q |
265 |
cagatgacagctgagtttcaagtcccctccccacaggttc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
529291 |
cagatgacagctgagtttcaagtcccctccccacatgttc |
529330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University