View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9673_high_1 (Length: 346)
Name: NF9673_high_1
Description: NF9673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9673_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 336
Target Start/End: Original strand, 5440066 - 5440383
Alignment:
| Q |
19 |
cacaaaactagcttagcagagcctatacaattaaggtcatgttgtttggctaatatgcataatttagagacattcaattaaacacaaaacttattttgct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5440066 |
cacaaaactagcttagcagagcctatacaattaaggtcacgttgtttggctaatatgcataatttagagacatccaattaaacacaaaacttattttgct |
5440165 |
T |
 |
| Q |
119 |
atatttacatctctttaccggtcttccattttctatctgttcatgtatttcttggtgtagctnnnnnnncgtcttgggaaatttttcggttaaaaaggaa |
218 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
5440166 |
atatttacatatctttaccggtcttcctttttctatctgttcatgtatttcttggtgtagctaaaaaaacgttttgggaaatttttcggttaaaaaggaa |
5440265 |
T |
 |
| Q |
219 |
aatatagtaaaatgagtgtgagccccgtgatttatttatttttgttgaaaagggtgcgtgatagccatggaggagaagaatttcattaaacattgattgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5440266 |
aatatagtaaaatgagtgtgagccccgtgatttatttatttttgttgaaaagggtgcgtgatagccatggaggagaagaatttcattaaacattgactgt |
5440365 |
T |
 |
| Q |
319 |
ttcttttccaaccctatg |
336 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5440366 |
ttcttttccaaccctatg |
5440383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University