View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9673_high_2 (Length: 262)
Name: NF9673_high_2
Description: NF9673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9673_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 1741193 - 1740959
Alignment:
| Q |
17 |
acaactgattttgatgactagcctgtgcaatgaggtattctgccatgacattgaagtccaaatgttaaggtcaaagataaacatgctagagcaaattacg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1741193 |
acaactgattttgatgactagcctgtgcaatgaggtattctgccatgacattgaagtccaaatgttaaggtcaaagataaacatgctagagcaaattacg |
1741094 |
T |
|
| Q |
117 |
cgatggtaataacaacatttatgggatatatatgtaacacctacacttcatattgaaggtttgtctagtgtcagtaattctgtaagggttttacaacgac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| | |
|
|
| T |
1741093 |
cgatggtaataacaacatttatgggatatatatgtaacacctacacttcatattgaaggtttgtctagtgtcagtaactctgtaaaggttttacaacgtc |
1740994 |
T |
|
| Q |
217 |
gcttcatattttacaacaaatcgaataaactaaca |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1740993 |
gcttcatattttacaacaaatcgaataaactaaca |
1740959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 42 - 114
Target Start/End: Complemental strand, 1735107 - 1735035
Alignment:
| Q |
42 |
tgcaatgaggtattctgccatgacattgaagtccaaatgttaaggtcaaagataaacatgctagagcaaatta |
114 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||| || ||| ||| ||| |||||||||| |
|
|
| T |
1735107 |
tgcaatgaggcatcctgccatgacattgaagtccaaatgttaaggtcgaacatagacaggctggagcaaatta |
1735035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 147 - 188
Target Start/End: Complemental strand, 2114760 - 2114719
Alignment:
| Q |
147 |
tatgtaacacctacacttcatattgaaggtttgtctagtgtc |
188 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
2114760 |
tatgtaacaccgacaattcatattgaaggtgtgtctagtgtc |
2114719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University