View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9675_high_12 (Length: 272)

Name: NF9675_high_12
Description: NF9675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9675_high_12
NF9675_high_12
[»] chr3 (1 HSPs)
chr3 (18-216)||(47661693-47661882)


Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 47661882 - 47661693
Alignment:
18 gattgccatggagatcaggagaatattagaggaatgtttgatgagaaggactcttgcagctcatgtagattatatctatactcagaaaatcatatcatcc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||    
47661882 gattgccatggagatcaggagaatattagaggaatgtttgatgagaaggactcttgcagct---------tatatctatactcagaaaatcatatcatcc 47661792  T
118 atggaatgacaatccatcacatgcatttagaatccaaataacttaataatataaataaatcaaagttataaacaagtaaaaaacatattgtccctatag 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47661791 atggaatgacaatccatcacatgcatttagaatccaaataacttaataatataaataaatcaaagttataaacaagtaaaaaacatattgtccctatag 47661693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University