View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9675_high_17 (Length: 248)
Name: NF9675_high_17
Description: NF9675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9675_high_17 |
 |  |
|
| [»] scaffold0098 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 13190371 - 13190491
Alignment:
| Q |
1 |
aactaaaataaaggtaaaagcagtggctgctacgtttggtgaaaggaggttaaaaacttcggtagttcaannnnnnnatcttgttttagaactttagttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
13190371 |
aactaaaataaaggtaaaagcagtggctgctacgttttgtgaaaggaggttataaacttcggtagttcaatttttttatcttgttttagaacttcagttg |
13190470 |
T |
 |
| Q |
101 |
caatattgtattttgctttta |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13190471 |
caatattgtattttgctttta |
13190491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 117 - 153
Target Start/End: Complemental strand, 17818137 - 17818101
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17818137 |
ttttagggttaatagtgttttatccccctgtaatata |
17818101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 157
Target Start/End: Original strand, 27637064 - 27637103
Alignment:
| Q |
118 |
tttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
27637064 |
tttagggttaatagtgttttatccgcctgtaatatatgtc |
27637103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 10761218 - 10761178
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10761218 |
ttttagggttaatagtgtttttcacccctgtaatatatgtc |
10761178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 34845631 - 34845591
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
34845631 |
ttttaggattaatagtgttttaattccctgtaatatatgtc |
34845591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 119 - 157
Target Start/End: Original strand, 34831488 - 34831526
Alignment:
| Q |
119 |
ttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34831488 |
ttagggttaatagtgttttatccccctgtaatatatgtc |
34831526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 157
Target Start/End: Complemental strand, 20962340 - 20962294
Alignment:
| Q |
111 |
ttttgcttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20962340 |
ttttgattttagggttaatagtgtttttcacccctgtaatatatgtc |
20962294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 157
Target Start/End: Original strand, 16303620 - 16303657
Alignment:
| Q |
120 |
tagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
16303620 |
tagggttaatagtgttttactcccctataatatatgtc |
16303657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 151
Target Start/End: Complemental strand, 25104114 - 25104082
Alignment:
| Q |
119 |
ttagggttaatagtgttttattcccctgtaata |
151 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
25104114 |
ttagggttaatagtgttttatccccctgtaata |
25104082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 157
Target Start/End: Complemental strand, 42336094 - 42336058
Alignment:
| Q |
121 |
agggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
42336094 |
agggttaatagtgttttttacccctgtaatatatgtc |
42336058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 117 - 153
Target Start/End: Original strand, 20089142 - 20089178
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20089142 |
ttttagggttaatagtgttttattcccctataatata |
20089178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 117 - 156
Target Start/End: Complemental strand, 44448701 - 44448662
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgt |
156 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
44448701 |
tttttgggttaatagtgttttatccccctgtaatatatgt |
44448662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 157
Target Start/End: Complemental strand, 15093752 - 15093707
Alignment:
| Q |
112 |
tttgcttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15093752 |
tttgctttcagggttaatagtgtttttcacccctgtaatatatgtc |
15093707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 153
Target Start/End: Complemental strand, 15994818 - 15994785
Alignment:
| Q |
120 |
tagggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
15994818 |
tagggttaatagtgttttatccccctgtaatata |
15994785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 153
Target Start/End: Original strand, 21022388 - 21022420
Alignment:
| Q |
121 |
agggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
21022388 |
agggttaatagtgctttattcccctgtaatata |
21022420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 153
Target Start/End: Original strand, 21443864 - 21443896
Alignment:
| Q |
121 |
agggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
21443864 |
agggttaatagtgttttatccccctgtaatata |
21443896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 153
Target Start/End: Complemental strand, 21522146 - 21522114
Alignment:
| Q |
121 |
agggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
21522146 |
agggttaatagtgttttatccccctgtaatata |
21522114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Original strand, 31079105 - 31079145
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31079105 |
ttttagggttaatagtgtttttcacccctgtaatatatgtc |
31079145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Original strand, 41745084 - 41745124
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41745084 |
ttttagggttaatagtgtttttcacccctgtaatatatgtc |
41745124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 157
Target Start/End: Original strand, 17158114 - 17158150
Alignment:
| Q |
121 |
agggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17158114 |
agggttaatagtgttttatacccctgtaatatatgtc |
17158150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 153
Target Start/End: Original strand, 2270447 - 2270483
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2270447 |
ttttagggttaatagtgttttacccccctgtaatata |
2270483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 156
Target Start/End: Original strand, 30126441 - 30126479
Alignment:
| Q |
118 |
tttagggttaatagtgttttattcccctgtaatatatgt |
156 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
30126441 |
tttagggttaatagtgttttttacccctgtaatatatgt |
30126479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 12369754 - 12369714
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
12369754 |
ttttagggttaatagtgttctttacccctgtaatatatgtc |
12369714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 29690755 - 29690715
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29690755 |
ttttagggttaatagtgtttttcacccctgtaatatatgtc |
29690715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 153
Target Start/End: Original strand, 48628135 - 48628177
Alignment:
| Q |
111 |
ttttgcttttagggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48628135 |
ttttgcttttagggttaatagtgtttttcacccctgtaatata |
48628177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 153
Target Start/End: Complemental strand, 5572331 - 5572298
Alignment:
| Q |
120 |
tagggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
5572331 |
tagggttaatagtgttttactcccctgtaatata |
5572298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 13439943 - 13439905
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13439943 |
ttttagggttaatagtgtttta--cccctgtaatatatgtc |
13439905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 153
Target Start/End: Complemental strand, 300548 - 300512
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
300548 |
ttttagggttaatagtgttttacccccctgtaatata |
300512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Original strand, 16343631 - 16343671
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16343631 |
ttttagggttaatagtgtttttaacccctgtaatatatgtc |
16343671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 38703364 - 38703325
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38703364 |
ttttagggttaatagtgtttta-ccccctgtaatatatgtc |
38703325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Complemental strand, 4250 - 4210
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4250 |
ttttagggttaatagtgtttttcacccctgtaatatatgtc |
4210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 153
Target Start/End: Original strand, 4102786 - 4102818
Alignment:
| Q |
121 |
agggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
4102786 |
agggttaatagtgttttatccccctgtaatata |
4102818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 157
Target Start/End: Original strand, 18164887 - 18164923
Alignment:
| Q |
121 |
agggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18164887 |
agggttaatagtgttttacccccctgtaatatatgtc |
18164923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 153
Target Start/End: Complemental strand, 14910133 - 14910101
Alignment:
| Q |
121 |
agggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
14910133 |
agggttaatagtgttttactcccctgtaatata |
14910101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 153
Target Start/End: Original strand, 21770749 - 21770785
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatata |
153 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21770749 |
ttttagggttaatagtgttttacccccctgtaatata |
21770785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 157
Target Start/End: Original strand, 31883448 - 31883487
Alignment:
| Q |
117 |
ttttagggttaatagtgttttattcccctgtaatatatgtc |
157 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31883448 |
ttttagggttaatagtgtttta-ccccctgtaatatatgtc |
31883487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University