View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9675_high_21 (Length: 239)
Name: NF9675_high_21
Description: NF9675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9675_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 36277700 - 36277929
Alignment:
| Q |
1 |
actgcctcgatgattatatgcacttgta-----tatgcccacttgatgagtacttgtaaaatcatggattctgatttctgtgtggtacttactacagaat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36277700 |
actgcctcgatgattatatgcacttgtacataatatgcccacttgatgagtacttgtaaaatcatggattctgatttctgtgtgttacttactacagaat |
36277799 |
T |
 |
| Q |
96 |
cagtagtaagcaaatcaataccattttgcttggatatcaaaattgtatcgattatgattttcttctcacctttgctttgttatatccaacaagaagaaaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36277800 |
cagtagtaagcaaatcaataccattttgcttggatatcaaaattgtatcgattatgattttcttctcacctttgctttgttatatccaacaagaagaaaa |
36277899 |
T |
 |
| Q |
196 |
agttgtattaacttttcactgttcattttg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36277900 |
agttgtattaacttttcactgttcattttg |
36277929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University